Ashleeagundiz9630 Ashleeagundiz9630

12-09-2022
Computers and Technology

contestada

Write a python 3 program that calculates how many years, days, hours, and minutes you have lived.

Respuesta :

Otras preguntas

A plant farm sells bundles of rose bushes. Each bundle contains 150 rose bushes and has the same ratio of hybrid tea roses, climbing roses, tree roses, and mini

Our eyes perceive colors because of differences in which of the following properties of light? a) Wavelength b) Intensity c) Source d) Angle

Please Help! I will give brainliest

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

-4=-5+v/14 what is v

Gemma had $2, 034 in her checking account. She wrote a check for $625 to pay the rent on her apartment. After the landlord cashed the check, how much money did

ok I really need help this is the last one I need the right answer pleasee and ill give brainliest but if u just want the points please don't submit a wrong ans

continuous nature of the physical fitness concept.

please help I need the right answer ill give brainliest pleaseee helpppp

the value of y in the system of equations is: