Jasoncookies23
Jasoncookies23 Jasoncookies23
  • 15-10-2018
  • Mathematics
contestada

brainliest!please help

brainliestplease help class=

Respuesta :

Lilozi
Lilozi Lilozi
  • 18-10-2018
The answer is 4 because the point x is equal to 4 on the graph
Answer Link

Otras preguntas

True or False. According to Marsiglia and Kulis (2015), a social worker should utilize culturally neutral services and methods when working with clients of diff
Two tracking stations are on the equator 163 miles apart. A weather balloon is located on a bearing of N 43°E from the western station and a bearing of N 17°E f
If your observation had not been restricted to the tip of the onion root, how would the results be different? (Hint: cells are only dividing in certain areas)
The vertex of the function f(x) = 2x² + 12x + 19 is at the coordinate (x, y), where: x = y =
complete ledger of sunland agency
A rental car company charges $53 per day to rent a car and $0.08 for every mile driven. Rashaad wants to rent a car, knowing that: He plans to drive 475 miles.
Why is Bangladesh one of the most fertile areas of the world?
Using the following genomic sequence: 1) Underline each intron 2) Circle each exon UUUAUGACUAAUGAUGAAUAAUAUAUGAUGCGUAGUAAUCCUUCUGCAGAUUAG AUAAUGUUUUUACCCACCAACG
through (3,3) perp to y=-3/8x+4 NEED HELP
Solve: 12x² +5x-4_122x+6 Ox=2 O x = -5 O x = 2, x = -5 Ono solution