shaniquecarmons shaniquecarmons
  • 12-11-2019
  • Biology
contestada

2. Use the mRNA sequence to find the DNA and complementary sequence and the
amino acid sequence.
DNA:
5'-
Comp strand: 3-
mRNA- 5'-AUGCCUACAUGUGGUGUAACCUU A-3'
Amino acids:

Respuesta :

angelbaby82
angelbaby82 angelbaby82
  • 12-11-2019
3- TACGGATGTACACCACATTGGAA -5
Answer Link

Otras preguntas

Increased leisure time has helped popularize nonfiction as a source of information. a. True b. False
a student decreases the temperature of a 556 cm balloon from 278 K to 231 K. Assuming constant pressure, what should be the new volume of the balloon be? a. 417
1. A valid hypothesis is one that is 1. testable and rejectable 2.proven true 3.verified without external evidence 4.accepted by publ
Leia a seguir o trecho da música “Emoções”, de Roberto Carlos: “São tantas já vividas, São momentos
In the human body the blood with the greatest concentration of oxygen is found in the
What is the electron structure of nitrogen? 1s22s22p3 1s22s23s22p1 1s32s32p1 1s12s12p5
Perhaps the greatest impact of the Freedmen's Bureau was that it:
what are two lasting legacies of portugal's history
In Which City was Muhammad Born?
What kind of instrument is a conga?