yvonneleal1976 yvonneleal1976

12-02-2020
Mathematics

contestada

There are 39 calories in 12 fluid ounces of a tea drink. Based on this information, how many calories are in 36 fluid ounces of the tea drink?

Respuesta :

12-02-2020

Answer:

117 calories

36/12=3

3x39=117

Answer Link

kaylamarenco251 kaylamarenco251

09-02-2021

Answer:

it was donld duck

Step-by-step explanation:

Answer Link

Otras preguntas

If the probability of a husband cooking eggs for breakfast is 0.1, the probability of a husband cooking bacon for breakfast is 0.3, and the probability of cooki

2. Dwayne scored 55 points in the last basketball game, which is 10 points more than his previous personal best. Lebron scored 15 points more than Chris in the

RNA: CATTGGCTAACGTCGATAATCGTCGGTAC 9. Which amino acids would be found in the mutation protein? Which amino acids would be found in the mutation protein

Home WorkConstructyour sentences in the pastperfect continuous tense prm.

1. What is the major determining factor in soil formation? Define this factor and explain how it influences soil formation. PLEASE HELP ME PLEASE

The number of hours children worked in the early 1800s was limited. O True False

how can the principle of Ubuntu be applied in the criminal justice system to ensure justice for victims

Jim rented a truck for one day. There was base fee of $17.95, and there was an additional charge of 87 cents for each mile driven, Jim had to pay $153.67 when h

create a SWOT/SWOC analysis of one of the following companies. ALDI LIDL Penneys/Primark Coca Cola Audi Tesco Dunnes Stores IKEA Topshop JD Sports

Which country is NOT labeled on this map?