Seudónimo Seudónimo
  • 14-04-2020
  • Mathematics
contestada

what does pants and shirts do for you???

Respuesta :

1001185 1001185
  • 14-04-2020

Answer:

they cover your body and keep u protected

Step-by-step explanation:

Answer Link
lennoxlee21 lennoxlee21
  • 14-04-2020
They keep yourself nice & warm
Answer Link

Otras preguntas

What would happen to the equilibrium price and quantity of lattés if the cost of producing steamed milk, which is used to make lattés, rises? a. The equilibrium
The faces of a cube are to be numbered with integers 1 through 6 in such a way that consecutive numbers are always on adjacent faces (not opposite ones). The fa
Abnormally increased blood levels of sodium are termed: a. hyperkalemia b. hypercalcemia c. hypernatremia d. hypercalcemia
How do you evaluate sin(13π/12)?
*WILL MARK BRAINLIEST! PLS ANSWER ASAP!!!* five less than four times a number is eleven. find the number
The largest organ of the human body is the skin. The total external skin area of the average human covers an area of approximately 2.0 meters squared. If you we
What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3' a) 5' CTGTATCCCAGACGGATATAACT 3' b) 5' TCAATATACCGTCTGGGTA
Tumor angiogenesis factor is so-called because it stimulates the growth of new _____________
What is f(4) is says to determine the input of the function when X=4.)​
Recycling paper reduces water use. Please select the best answer from the choices provided T F