Iwritewithpencils Iwritewithpencils

14-05-2020
Biology

contestada

How do I use a codon wheel to solve this sequence of DNA?

AGTACCCGTTAATTAGTTGCCG

Respuesta :

andyk38105 andyk38105

14-05-2020

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

Answer Link

Otras preguntas

how do you solve the equation 2.25t + 5 = 13.5t +14

how many years can it be for it to be an election year (like how many years after it when the president is settled with and then the election year comes back)

why is one sixth greater than one eighth but less than one third Explain

Which one is the best explanation of energy? a. making transformations b. the ability to do work c. conservation of power d. measuring joules

Georgia politician, teacher, and reformer Rebecca Latimer Felton became United States Senator

Industrial production fell due to a lack of raw materials in Japan after WWI. a. True b. False

The base of a triangle is represented by x - 4, and the height is represented by x + 4. Which of the following represents the area of the triangle? 1. x2 - 1

For Odysseus and his men, the loss of Helios, the sun, symbolizes a loss of what?

in what year did the us economic recovery begin?

describe how the condition required for natural selection, including overproduction of offspring inherited variation and the struggle to survive, which results