sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

What is the length of the earth's crust? Oceanic and Continental.

Explain how you know that 7/12 is greater than 1/3 but less than 2/3?

How is the coastline of new jersey different from the coastline of Maine

8x+15=3x-20 how do you do this

Use the form y=mx +b for linear equations.Write the equation for the following relation.C = {(x, y): (6, 15), (8, 21), (10, 27), . . .}

8x+15=3x-20 how do you do this

A metal box, attached to a small parachute, is dropped from a helicopter. explain in terms of the forces acting; why:(i) its velocity increased immediately afte

Use the form y=mx +b for linear equations.Write the equation for the following relation.C = {(x, y): (6, 15), (8, 21), (10, 27), . . .}

95 is 95% of what number?

Use the form y=mx +b for linear equations.Write the equation for the following relation.C = {(x, y): (6, 15), (8, 21), (10, 27), . . .}