dianapaola2121
dianapaola2121 dianapaola2121
  • 15-05-2020
  • Mathematics
contestada

Domain is the set of all input values, while range is the set of all:
independent variables
C. relations
b. output values
d. functions
а.

Respuesta :

hannahgalindo23
hannahgalindo23 hannahgalindo23
  • 15-05-2020
I am thinking it will be d . Functions
Answer Link

Otras preguntas

Suppose that you are a trader visiting Constantinople for the first time. Write a few sentences to a friend back home describing what you see as you walk throug
Solve this equation by graphing.First graph the equation then type the solution Y=1/3x+6 Y=1/6x+5
What happens to the amount of DNA in the nucleus just before the beginning of mitosis and why? A The amount of DNA is doubled so that the two new cells each hav
Frenchhhh helppppppp
What is 25x+1 = 125x-1?
(100 points!) When you are responding to a seemingly simple question. It is important to define your term. In this case what does it mean to be a winner? In the
Subtract the polynomial: x2 + 2x + 1 – (x – 3)
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
write an essay about homelessness is Louisiana
What is the image of (-4,4) after a dilation by a scale factor of 1/4 centered at the origin?