24Hunderuph 24Hunderuph

15-05-2020
Chemistry

contestada

What happens when light passes from air into water?
A) The light speeds up
B) The light continues at the same speed
C) The light slows down
D) The light forms a mirage

Respuesta :

kashkaiser21 kashkaiser21

15-05-2020

The answer is C . when the light slows down

Answer Link

Otras preguntas

Pls halp I need it fast so please try your best to be fast

Evaluate the expression when a= 4, b= -6, c= -12

2. One angle of a triangle measures 10 degrees more than the second. The measure of the third angle is twice the sum of the measures of the first two angles. Fi

1/6 divided by 4 i need the answer please thank you.

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

I GIVVVEEE BRAINLISTTTTTTTTTT

The oxidation of glucose to two molecules each of pyruvate, ATP, and NADH is called ________ and occurs in the ______.

What is the difference between the House and Senate regarding who sets the rules?

I need help asap please

Which of the following would be the best thing to do to reverse the impact humans have had on the enviroment? A. Change the way we approch scienceB. Stop growin