Arlene138 Arlene138

13-06-2020
Mathematics

contestada

question 18: please help. I will give brainliest to correct answer.

question 18 please help I will give brainliest to correct answer class=

Respuesta :

13-06-2020

Answer:

3. mean of 2nd is larger

Step-by-step explanation:

mean of 2nd sem 87 > 86.8 1st sem

Answer Link

zbelcher zbelcher

13-06-2020

Answer:

3

Step-by-step explanation:

Answer Link

Otras preguntas

helppppppppppppppppppppppppp

Out of 1100 discs tested 13 are defective. Estimate the number of defective discs in a batch of 41000

nadiyah found the circumference of a circle with a diameter of 4.9 in to be 20in. is her answer reasonable? explain

What is the key characteristic of sponges and how are they involved in the sponges filter feeding process?

Tom with type AB blood marries Anna. They have two children: Eric with type B blood and Jessica with type A blood. Anna’s father Paul has type O blood, and her

Crystallization occurs if a tiny amount of solute, called a seed crystal, is added to a ______ solution. An example of this happens when we make rock candy. A)

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

a large spherical balloon

In this assignment, you'll revisit the topic of stage directions and explore additional ways they can develop literary elements in a play. Read the example:

12 is equal to the product of 6 and X turn into an equation