yfuutduufnfqeniq yfuutduufnfqeniq

12-09-2016
Spanish

contestada

¿____________ está el parque?

Respuesta :

cupcakequeen23 cupcakequeen23

12-09-2016

It means Yellow Stone National Park

Answer Link

12-09-2016

u would "set the table" in the cocina

Answer Link

Otras preguntas

Anyone know the answer? It would help tons ‍♀️ taking a placement test yk got to do what you got to do‍♀️

What were some important ideas in the new state constitution

pls can u help me answer this❔

An increase of 180 degrees in Fahrenheit is equal to an increase of how many degrees in celsius?

THIS IS THE BOOK REFUGEE! Describe the scene where you saw the theme in Josef’s story. Textual evidence must be provided with the direct quote or paraphrase and

What is the complementary strand of DNA to the one below? AAACCGTATCCGCGGTATATCGCCGGAAT

Chan was working on a painting of the Golden Gate Bridge. He was almost done but was at a loss for ideas on the shade to use for the outer horizon in his painti

What is anti-Semitism? Why was Adolf Hitler prejudiced against Jews? Please help

Which statement provides the best summary of Chapter 5? *

plz help me i really need help like really plz help asap asap ASAP PLZ HELP ME