i1nizam1i
i1nizam1i i1nizam1i
  • 13-10-2020
  • Biology
contestada

DNA: TAC-GGC-ATA-GCA-TTT-CAC-TAA



What is the corresponding RNA sequence for the DNA strand above?

DNA TACGGCATAGCATTTCACTAA What is the corresponding RNA sequence for the DNA strand above class=

Respuesta :

zorsip
zorsip zorsip
  • 13-10-2020

Answer:

Changing G to C

C to G

A to U

and T to A, the answer will be C

Answer Link

Otras preguntas

What is a subordinating conjuction
need help/info on science homework just question#5
Etiquette refers to a person’s _____ and _____.
Jenny’s frog made one jump of 2.34 m. Christina’s frog made jumps of 1.22 m and 0.89 m. How much further did Jenny’s frog jump in one jump than Christina’s frog
What are the only elements that exist in nature as uncombined atoms?
How have resident's of the west adapted to their environment give 3 ways
Sugiero que / Arturo y Ana / pagar con cheques de viajero
How did Christopher Columbus interact with the natives when arriving in the "new world"?
How should the sentence below be rewritten to avoid incorrect punctuation? "What is the name of your dog"? my friend asked.
Why did Alexander Hamilton choose to support Thomas Jefferson instead of Alexander Burr?