haydenrosejackson1 haydenrosejackson1

15-10-2020
Biology

contestada

What is the complementary strand for this segment of DNA? I'll give u 15 point pls answer

What is the complementary strand for this segment of DNA Ill give u 15 point pls answer class=

Respuesta :

zayveionbrown zayveionbrown

15-10-2020

I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC

Answer Link

Otras preguntas

List the five types of cream and their levels of milk fat.

Who settled in Brazil once it was Colonized?

How do you think your dietary practices affect your physical social and mental health

What does price fixing involve? A. A large company charging below its production cost in order to eliminate competition B. A cartel setting a maximum out

After 1793, what crop became the number one cash crop grown and sold in Mississippi

Which is a common symptom that results from an overactive thyroid gland? hair growth weight loss low insulin levels onset of diabetes

please help me ACED !!!is it a or b ? im confused

Find the Nile delta on the map how far from the Mediterranean sea is giza

The highlands region has hills that run the length of the Coast

Identify the option containing a sentence fragment. A. She packed and repacked her suitcase. At least twenty times. B. She packed and repacked her suitcase at l