salvoporgracia1982 salvoporgracia1982

13-11-2020
Mathematics

contestada

) Encuentra dos números consecutivos cuya suma sea 57.

Respuesta :

antoniogreer antoniogreer

13-11-2020

Answer:

k

Step-by-step explanation:

k

Answer Link

Otras preguntas

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.

Drag the word to the description it matches. Each word may be used more than once. consent of the governed absolute monarchy total control authoritarian dictato

A box of mass M is attached to another smaller box of mass m by a lightweight cord and hung over opposite sides of a lightweight pulley. The whole system is rel

Please Help me immediately. this is due at 11:59pm Priya bought these items at the grocery store. Find each unit price. 10 apples for $3.50. How much is the co

I need step by step question

An equation is shown. y-7= -4(x+6) Complete the statements. The equation rewritten in slope intercept form is [DROP DOWN 1]. The point [DROP DOWN 2] is on the g

Suppose that a firm has the option to make or buy a part. Its annual requirement is 19,000 units. A supplier is able to supply the part at $10 per unit. The fir

Which phrase is an example of kinetic energy?

any one want to talk i'm so boreed

What's Roman mean in the bible?