hlichialee hlichialee

11-10-2016
Mathematics

contestada

If Two isosceles triangles that each include an angle measuring 120∘ , are they similar triangles.

Respuesta :

11-10-2016

They could be CONGRUENT then.

Answer Link

Otras preguntas

The firm's targeted customers and the operations and supply chain functions needed to provide value to them are identified in the?

Only 5% of male high school basketball, baseball, and football players go on to play at the college level. Of these, only 1.7% enter major league professional

Why do you think Aaron and Bear keep reminding Chase of the not-so-nice things done, like eating cookies from the snack cart?

What is the ratio of the intensities of an earthquake P wave passing through the Earth and detected at two points 15 km and 49 km from the source

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

What are the expected genotypic ratios from the cross of two heterozygous tall plants (Tt x Tt)? 50% TT : 50% tt 50% TT : 50% Tt 50% TT : 25% Tt: 25% tt

Richard and Teo have a combined age of 21. Richard is 6 years older than twice Teo’s age. How old are Richard and Teo?

220-109.4 how to solve ?

The element boron exists in nature as two isotopes: 10B has a mass of 10.0129 u, and 11B has a mass of 11.0093 u. The average atomic mass of boron is 10.81 u. C

5. A change in an organism's environment that causes the organism to react is called a(n)