itzmehturtle1 itzmehturtle1

11-03-2021
Mathematics

contestada

Find the space inside a rectangle with a width of 8 and a length of 15.

Respuesta :

kkrishnakk782 kkrishnakk782

11-03-2021

Answer:

120

Step-by-step explanation:

A=LxH

So 15x8=120

Answer Link

Otras preguntas

mrs.huynh bought a bag of 3 dozen toy animals as party fafvors for her sons birthday party.the bag of toy animals $28.97.estimate the price of each toy animal

how does the narrator's point of view change how the events are being described

solve for x: x-2/x+4=x+2/x+12 help please

"You always want to do what I do, Polly thought. She sighed and leaned over to talk to her sister eye-to-eye. 'You're too little to run a business like me. You

Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3

difference between ca and ca2+

What is the equation of the line passing through the points (–25, 50) and (25, 50) in slope-intercept form?

Taylor mixes two liquids together in a beaker. A solid forms at the bottom of the beaker, and the liquid changes from pink to blue. Which of the following is tr

Is the underlined word a noun, or proper noun? CHRISTMAS is my favorite holiday.

A 5-pound bag of apples cost $3.50. Use that rate, to complete the table to identify equivalent ratios, and then answer the questions. Apples*?5?15 Cost0.703.