sofia52545
sofia52545
13-03-2021
English
contestada
What is an informed opinion
Respuesta :
ItsRainingTd
ItsRainingTd
13-03-2021
Answer:
a belief, judgment or way of thinking about something based on information
Answer Link
VER TODAS LAS RESPUESTAS ( 13+ )
Otras preguntas
C14 is another radioactive substance with a half-life of 5730 years. If a mammoth died with 2000 grams of C14 and then its fossilized bones were found to have j
Mr. Chin asked his class to solve for y in the equation 8(3y - 5) = 9(y - 5) -1. Explain how to solve for y. Then solve.
An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated
3. (a) In "Money," which details suggest the nature of the children's lives? (b) How do these details contrast with those that describe the people at the door
PLEASE SOMEONE HELP Midsummer Night Dreams ACT 1 Analyze the following quote: Find the context of the quote, significant to story, poetic device use and for wh
A red laser light strikes the face of a triangular prism. What will be observed merging from the other side of the prism? a. no light b. red light c. white ligh
Write the expression using exponents. 5.2 x y x y x y The ( X ) stands for multiplication. So 5.2 times Y times Y times Y.
The polynomial function p(x) = x^4 + 4x^3 -7x^2 - 22x +24 has known factors of (x +4 ) and (x-1 ) Rewrite p(x) as the product of linear factors Draw a rough s
What are the function of the Auxin hormone in plant's. Choose the correct answer A ) ! ck jd pyk v zc ! B ) ! ck jd pyk v zc !
If your starting balance is $250, what is your new balance after a withdrawal of $56.50 and a deposit of $25.00?
