sierra190
sierra190 sierra190
  • 13-05-2021
  • Mathematics
contestada

what’s the answer???

whats the answer class=

Respuesta :

michaelanderson93 michaelanderson93
  • 13-05-2021

Answer:

dude unit test reviews dont matter you can fail that and move on

Step-by-step explanation:

Answer Link

Otras preguntas

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperature (tm) of 5
A $136,000 trust is to be invested in bonds paying 8% CD is paying 7% in mortgages paying 10% the bond and CD investment must equal the mortgage investment to e
Oliver needs to purchase new equipment for his team in order to complete his project on time. His budget for purchasing new equipment, however, will depend on w
Someone please help me??
Graham Corporation has the excess manufacturing capacity to fill a special order from Nash, Inc. Using Graham’s normal costing process, variable costs of the sp
A 12-foot ladder is leaning across a fence and is touching a higher wall located 3 feet behind the fence. The ladder makes an angle of 60 degrees with the groun
I need help92929292220
Samira bought 156 ounces of trail mix.She wants to divide the amount equally into 24 portions.How many ounces of trail mix will be in each portion? (Feel free
On her way home from school, Doris always checked the mailbox to see if any mail had come. Today, there wasn't anything in the mailbox, but there were three box
2. What are the three substances that generally make up paint? Describe each part.