nicole584 nicole584

14-05-2021
Mathematics

contestada

Which factor is common to both 2+7+10 and 2−−6?

Respuesta :

llol0l0ol0ol llol0l0ol0ol

14-05-2021

Answer:

2

Step-by-step explanation:

Answer Link

Otras preguntas

List all the terms in the expression, 3x + 5x – 2. Group of answer choices 3x , 5x, and -2 3 and 5 x and x and -2 3, 5, and -2 Thx!

How might a stray animal feel When abandoned?

3.) Find the coordinates of Triangle KLM after a translation to the right by 8 units, then a reflection across the x-axis. Show your work or explain what steps

Drag each tile to the correct box. Arrange the rooms in increasing order of their areas. bedroom hallway drawing room kitchen TV room

Chelsea looked over her previous bank statements from her old bank. She noticed that, on average, she used a third-party ATM three times a month and the third-p

30 points if someone answers this quickly <3 Jacqueline has two part-time jobs. She earns $15 per hour, l, working as a lab assistant, and $12 per hour, s, w

An illustration of how a particular DNA mutation will most likely affect the polypeptide produced is shown. (Original DNA strand) GTAGTAGTAGTAGTAGTAGTA (Mutated

what is the answer to this question?

In the figure above, is AB || CD? 1. If m 2 5= 30 and m < 3 = 150? A. Yes because angles 5 and 3 are same-side interior angles. OB. Yes because angles 5 and

Lab: Calorimetry and Specific Heat this is the answer <3