smiley66 smiley66

11-11-2021
Social Studies

contestada

How would you characterize the tone of the poem "Brown Man's Burden"?

Respuesta :

ligarliwal ligarliwal

11-11-2021

Answer:

Tone may be formal, informal, intimate, solemn, somber, playful, serious, ironic, guilty, condescending, or many other possible attitudes.

Explanation:

brainliest pls

Answer Link

Otras preguntas

The sum of two numbers is 36. The larger number is 14 more than the smaller number. What are the numbers?

Find the vertex. f(x) = 10x2 – 17

What was one major weakness of the Articles of Confederation? A. It took most political power away from individual states. B. It allowed Congress to set high ta

. _____ The Supreme Court takes on a case about the constitutional merits of a law. After hearing arguments for and against the law, they issue a verdict that t

be good peeps Express both quantities in each comparison using the same units. Write the comparison as a ratio in fraction form. Then write an equivalent ratio

Match the types of camcorders to their features. MiniDV DVD HDD combo has a built-in hard drive Uses either a hard drive or a flash drive for recording records

The following DNA is being replicated and the origin of replication is in the middle of the sequence and marked with three stars ***. 5'ATCGGGCTACCCATGAAATGCTA

Answer pleaseeeee hurry fast

What pounds per square inch is required by a bubbler system to produce bubbles at a depth of 4 ft 7 in water?

What pounds per square inch is required by a bubbler system to produce bubbles at a depth of 4 ft 7 in water?