connerfausett
connerfausett connerfausett
  • 11-12-2021
  • Biology
contestada

100 points, I need help filling this out.

100 points I need help filling this out class=
100 points I need help filling this out class=

Respuesta :

elliebelliebear13 elliebelliebear13
  • 11-12-2021

Answer:

can u put a less blurry pic?

Explanation:

Answer Link

Otras preguntas

How much water was used on Monday Wednesday Friday
One moving company charges $800 plus $16 per hour.another moving company charges $720 plus $21 per hour. At what number of hours will the charge by both compani
2. How many cups of flour are needed to make 6 cupcakes? A. 1 Cup B. 1 1/4 cup C. 1 1/2 cup D. 2 cups
Find the 9th term of the sequence 4, 12, 36, 108
A set of tires is designed to last 6 years, with a standard deviation of 2 years. What is the probability that a tire will last less than 4 years? 1% 10% 16
Integrated communications are necessary to achieve situational awareness. (True/False)
Replicate the following DNA strand: 5' ATTGCGAACTGCGAGGACTTC 3'
Putting the baby to bed with a bottle. a. Not recommended b. Recommended
74 meters long and 45 meters wide what is the area of the land
Read this excerpt from The Miracle Worker.CHILDREN [DELIGHTED]: There’s another present! Beatrice! We have a present for Helen, too! Give it to her, Beatrice. H