divaparra014 divaparra014

14-02-2022
History

contestada

Can someone please help me? :( I will give brainliest!!

Can someone please help me I will give brainliest class=

Respuesta :

rodgerskaydin5 rodgerskaydin5

14-02-2022

Answer:

b is anwser hope

it helps :)

Answer Link

pinkneydevin58 pinkneydevin58

14-02-2022

B is the anwser I hope this helps

Answer Link

Otras preguntas

Navy paint is made by mixing 8 cups of blue paint with 2 cups of black paint. If he only has 1 cup of blue pain, how much black paint should he use?

Marilyn purchased 2,000 shares of stock for $25.43 per share. She sold them for $44.10 per share. Express her capitol gain to the nearest tenth of a percent.

Use dimensional analysis to convert the following: 85 mi/h to m/s. You must show clear work in order to receive full credit. You must use the following two rela

A plane flies due north (90° from east) with a velocity of 100 km/h for 3 hours. During this time, a steady wind blows southeast at 30 km/h at an angle of 315°

in a rectangle, one side is 3 times as long as the other. Now the longest side is extended by 4m. Then the area will be 96 square meters larger. How long were t

On February 1, 2004, Zhang entered into a contract to buy former realtor Frank Sorichetti’s Las Vegas home for $532,500. The contract listed a March closing dat

Actually it’s for statistics, need answer fast please

How many minimum people are required to guarantee that at least 2 of them are born on the same day of the year?

Copper(II) sulfate crystals, CuSO4.5H₂O, can be made by heating copper(II) oxide with dilute sulfuric acid and then crystallising the solution formed. a Calcul

Below the Dna strands. Make the complimentary DNA Strands :(Original strand : ATGCAAATTGCTCACCGGGGATCAGCACCGG) Complementary strands.