mvaldez6768 mvaldez6768
  • 14-06-2022
  • Mathematics
contestada

Divide the following and round to the nearest hundredth: 7742.1/48

Respuesta :

SupremeTurtle
SupremeTurtle SupremeTurtle
  • 14-06-2022

Answer:

161.29

Step-by-step explanation:

7742.1/48 = 161.29375
_________________________________________
if you plug that in into a calculator

Round to the nearest hundredth: 161.29375

you know it stays the same because 3 rounds down.

so you get 161.29
_________________________________________

Hope this helps :)

Answer Link

Otras preguntas

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the
On Venus, a day is longer than a year True or False
What geographic theme of movement stresses the idea of?
When is it unnecessary to follow a direct quotation with a parenthetical citation that includes the name of the source?
If you have a long title for a table and need it to span several cells you use
Which scientists contributed to discovering the universal law of gravitation? Check all that apply. Tycho Brahe Albert Einstein Johannes Kepler Nicolaus Copern
When modeling hourly pay, which part of the equation is used to represent a signing bonus? A. y B. x C. Slope D. y-intercept
Is Female A, Homozygous or Heterozygous... also how do I find it out. Ty :3
Plz help and show the work I need help with#1 and #2
Psychologist hans eysenck used factor analysis to identify patterns of traits and found that personality could best be described in terms of just three major di