thatonechild thatonechild

15-07-2022
Biology

contestada

What is the replicated DNA sequence for GGC GAG AAT GAA ACT ATT TGT AGC

Respuesta :

ariahuds8154 ariahuds8154

15-07-2022

Answer:

ccgctcttactttgataaacatcg

Answer Link

Otras preguntas

The oldest known legal system is contained in the

What is the main reason that attitudes are more often revealed in spoken rather then written language?

a supermarket sells 4 apples for $3 and 3 oranges for $4 . if lyndsey buys 12 apples and 12 oranges , how much money will she spend on fruit?

Enter the answer to the problem below, using the correct number or significan figures 100*3.25

Ann and Joes farther donated $3 for every lap they swam in a swim-a-thon.Ann swam 21 laps, and joe swam 15 laps.Use the. Distributive Property to find the amoun

If nondisjunction occurs and an individual survives, which disorder can occur? Klinefelter syndrome fragile X syndrome DiGeorge syndrome Robertsonian translocat

Hawthorne reveals his feelings about his Puritan ancestors when A. the dark man reveals that he helped Brown's forebears persecute others. B. Faith expresses

product of 8/15, 6/5, 1/3 is

whats the difference between purine and pyrimidine?

An NBA game is 48 min long.If Lebron James ate a Big Mac Extra Value Meal ( that is 1360 calories) before a game, would he burn off all the calories by the end