livinglife277
livinglife277
13-03-2017
Mathematics
contestada
Help on 10,14 and 15 plzz
Respuesta :
doodledeedum
doodledeedum
13-03-2017
10. 4(3d - 2) = 8d - 5
12d - 8 = 8d - 5
12d - 8d = 8 - 5
4d = 3
d = [tex] \frac{3}{4} [/tex]
14. I need the picture of the square and triangle.
15. V = [tex] \frac{1}{3} [/tex]Bh
3V = Bh
[tex] \frac{3V}{h} [/tex] = B
Answer Link
VER TODAS LAS RESPUESTAS ( 82+ )
Otras preguntas
Mr. Bunt invests x GBP in this bank and the amount of money in his account after 5 years is 4000 GBP.Calculate the number of years that it would take for Mrs. A
Which of the following are elements of whistleblowing? 1) The action taken by the organization to counteract the whistleblower 2) The organization against which
You are going to use an incline plane to lift a heavy object to the top of a shelving unit with a height of 6 ft. The base of the incline plane is 13 ft from th
In which phase of a contraction is calcium actively transported back to the sarcoplasmic reticulum?
what is the area of a circle that is placed inside a square and the side length is 4 cm ?
Calculate the molecular weight of NH₃?
During transcription, the first transcription factor to bind to DNA is chemically attracted to a DNA sequence called a(n) ___________?
Replicate the following gene strand, and then transcribe the template strand:GTTAATGGCCATGATGGCTTTGTGATTAAGC .Translate the mRNA from above using single letter
The pH's of eight 0.1M aqueous salt solutions are given below. Write the hydrolysis equation(s) for each. (Several will have more than one equation.) If no hydr
When ethyl alcohol depresses brain function, is it displayed as bad judgment?
