melodyC1heehutt melodyC1heehutt
  • 15-05-2017
  • Biology
contestada

What is the membrane that covers the eye of a frog?

Respuesta :

fingazization fingazization
  • 15-05-2017
the nictitating membrane
Answer Link

Otras preguntas

25 POINTS : Which translation will change figure ABC to figure A'B'C'? 3 units right and 3 units up 4 units right and 3 units up 4 units right and 4 units
What did early societies in North America have in common?
Sort the following fungi based on whether they are decomposers, mutualists, or parasites.
the author of the editorial "rethinking ground zero" believes that
Which statement best describes the way that relationships can progress to violence
make the indicated conversion assume a 360-day year as needed,8months to simplified fraction of a year
There are 6 glass bottles and 8 plastic bottles on a rack. If one is chosen at random what is the probability of picking a glass bottle? Which simulation can be
Is 3y = x a function?
A teacher sets up a stand carrying a convex lens of focal length 15 cm at 20.5 cm mark on the optical bench. She asks the students to suggest the position of th
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’