AliOsman332
AliOsman332 AliOsman332
  • 13-01-2016
  • Mathematics
contestada

Write the ways to solve it too plz

Write the ways to solve it too plz class=

Respuesta :

taskmasters
taskmasters taskmasters
  • 13-01-2016
A.) -540

Sum = N (first number + last number) / 2

N = count of consecutive numbers. Had the numbers included 1, then, N would have been 33. Since its range is 7 - 33 then 33 - 7 + 1= 27. 
N = 27

Sum = 27 (-33 - 7) / 2
sum = 27 (-40)/2
sum = -1080 / 2
sum = -540
Answer Link

Otras preguntas

The graph below shows the distance John hiked while camping at Sweetwater Park. What was his average rate of change between hour one and hour three?
how do you solve 21/4=1/2x+3x and whats the answer?
Which of the following best symbolizes the friendship of Georg and ulrich
The Orchard Pie company uses 95 pounds of apples. How many pounds of apples are used in each pie?
what did the discovery at knossos reveal about the minoans
How to rewrite an expression using the GCF? My question is Find the GCF and rewrite the expression. 4x + 12
In JavaScript, which of the statements below can be used for string declaration? 1) var cst="PHPKB Knowledge Base Software"; 2) var cst=new String("PHPKB Knowle
Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequences are always written 5' to 3
heat is simply another word for?A.All the above B.Temperature C.Thermal energy that flows from hot to cold D.Thermal energy
Where is the thylakoid located in a cell? A. In chloroplasts B. In the cell wall C. In the cell membrane D. In the cytosol